About   Help   FAQ
Tnfr2-pA, Tnfr2-pB Primer Detail
Primers
  • Name
    Tnfr2-pA, Tnfr2-pB
  • Primer 1 Sequence
    AATCAGGTAGGACAGGAAGG
  • Primer 2 Sequence
    CCTGGCTACATGAAGTGTTC
  • ID
    MGI:239
Genes
Tnfrsf1b tumor necrosis factor receptor superfamily, member 1b
Polymorphisms
J:12633 Takao S, et al., Immunogenetics. 1993;37(3):199-203
Notes: Unique sequence flanking the microsatellite were synthesized to use in PCR amplification.
Endonuclease Gene Allele Fragments Strains
Tnfrsf1b a 219bp AKR, BXSB, C3H, CBA, DBA/1, NON, PL/J
b 227bp BALB/c, C57BL/6
c 207bp DBA/2, P/J, SWR
d 203bp NOD, NZB, NZW, SJL/J, SM/J
e 217.0bp MRL-Faslpr
m 209.0bp M. m. domesticus poschiavinus, M. m. musculus
s 211.0bp M. spretus
References
J:12633 Takao S, et al., Novel DNA polymorphism in the mouse tumor necrosis factor receptors type 1 and type 2. Immunogenetics. 1993;37(3):199-203

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory