About   Help   FAQ
T59 Primer Detail
Primers
  • Name
    T59
  • Primer 1 Sequence
    ACCTCAGCGGTTCTTTATGAG
  • Primer 2 Sequence
    TGGTCCACCCTGAATGAGTCC
  • ID
    MGI:231
  • Product Size
    90bp
  • Synonyms
    TJ-2.29
Genes
D6Nds4 DNA segment, Chr 6, Nuffield Department of Surgery 4
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D6Nds4 n smaller AKR/J, B6.PL-Thy1a/SnJ, C57BL/6, C57BL/10-H2g7, DBA/2J, NOD, NON
s larger M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D6Nds4 e 91bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
f 114bp CAST/EiJ
s 112bp SPRET/EiJ
J:29406 Davies PO, et al., Mamm Genome. 1995 Oct;6(10):738-40
Endonuclease Gene Allele Fragments Strains
D6Nds4 n not given NOD
p not given PWK/Pas
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D6Nds4 m 88bp MOLF/EiJ
s 130bp 129/Sv
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:15643 Peichel CL, et al., Mapping the midkine family of developmentally regulated signaling molecules. Mamm Genome. 1993 Nov;4(11):632-8
J:29406 Davies PO, et al., An anchored molecular map of mouse chromosome 6 with an analysis of interference. Mamm Genome. 1995 Oct;6(10):738-40
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory