About   Help   FAQ
MyoD-pG, MyoD-pB Primer Detail
Primers
  • Name
    MyoD-pG, MyoD-pB
  • Primer 1 Sequence
    AGGCTCTGCTGCGCGACC
  • Primer 2 Sequence
    TGCAGTCGATCTCTCAAAGCACC
  • ID
    MGI:2178589
  • Product Size
    491bp
Genes
Myod1 myogenic differentiation 1
Expression
  • Assay Results
    65
References
J:767 Hannon K, et al., Temporal and quantitative analysis of myogenic regulatory and growth factor gene expression in the developing mouse embryo. Dev Biol. 1992 May;151(1):137-44
J:29279 Patapoutian A, et al., Disruption of the mouse MRF4 gene identifies multiple waves of myogenesis in the myotome. Development. 1995 Oct;121(10):3347-58
J:31611 Wang Y, et al., Functional redundancy of the muscle-specific transcription factors Myf5 and myogenin. Nature. 1996 Feb 29;379(6568):823-5
J:42574 Floss T, et al., A role for FGF-6 in skeletal muscle regeneration. Genes Dev. 1997 Aug 15;11(16):2040-51
J:49013 Yamane A, et al., Induced expression of myoD, myogenin and desmin during myoblast differentiation in embryonic mouse tongue development. Arch Oral Biol. 1998 May;43(5):407-16
J:63331 Yamane A, et al., Expression of myogenic regulatory factors during the development of mouse tongue striated muscle. Arch Oral Biol. 2000 Jan;45(1):71-8
J:74099 Yamane A, et al., Delayed embryonic development of mouse masseter muscle correlates with delayed MyoD family expression. J Dent Res. 2000 Dec;79(12):1933-6
J:175458 Bren-Mattison Y, et al., Growth of limb muscle is dependent on skeletal-derived Indian hedgehog. Dev Biol. 2011 Aug 15;356(2):486-95

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory