Ms10l-primerF,Ms10l-primerR Primer Detail MGI Mouse MGI:2153028

About Help FAQ

Ms10l-primerF,Ms10l-primerR Primer Detail

Name

Ms10l-primerF,Ms10l-primerR
Primer 1 Sequence

CTTTGGTTCCCAGAGACCAGC
Primer 2 Sequence

CACGCTGCAGGCAATACAGTG
ID

MGI:2153028

Ms10l

minisatellite 10l detected by probe MMS10

J:69106 Bois PR, et al., Mamm Genome. 2001 Feb;12(2):104-11

Gene	Allele	Fragments	Strains
Ms10l	a	not given	C3H/J, CBA/J, P/J
	b	not given	A/J, BALB/cJ, DBA/2J, FVB/NJ, SJL/J, SWR/J
	c	not given	C57BL/6J
	k	not given	AKR
	s	not given	SPRET/EiJ

J:69106 Bois PR, et al., Length of uninterrupted repeats determines instability at the unstable mouse expanded simple tandem repeat family MMS10 derived from independent SINE B1 elements. Mamm Genome. 2001 Feb;12(2):104-11

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23