About   Help   FAQ
Cryaa-pA, Cryaa-pB Primer Detail
Primers
  • Name
    Cryaa-pA, Cryaa-pB
  • Primer 1 Sequence
    GACTGTTCGACCAGTTCTTCGG
  • Primer 2 Sequence
    GAAGGTCAGCATGCCATCAGC
  • ID
    MGI:2149371
  • Product Size
    365bp and 434bp
  • Synonyms
    alphaA-crystallin
Genes
Cryaa crystallin, alpha A
Expression
  • Assay Results
    22
References
J:46636 Nishiguchi S, et al., Sox1 directly regulates the gamma-crystallin genes and is essential for lens development in mice. Genes Dev. 1998 Mar 15;12(6):776-81
J:56095 Kawauchi S, et al., Regulation of lens fiber cell differentiation by transcription factor c-Maf. J Biol Chem. 1999 Jul 2;274(27):19254-60
J:56583 Ring BZ, et al., Regulation of mouse lens fiber cell development and differentiation by the Maf gene. Development. 2000 Jan;127(2):307-17
J:80609 Kim SW, et al., Multiple developmental defects derived from impaired recruitment of ASC-2 to nuclear receptors in mice: implication for posterior lenticonus with cataract. Mol Cell Biol. 2002 Dec;22(24):8409-14
J:86801 Hirano M, et al., Generation of structures formed by lens and retinal cells differentiating from embryonic stem cells. Dev Dyn. 2003 Dec;228(4):664-71

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory