About   Help   FAQ
Gtf2i-pA, Gtf2i-pB Primer Detail
Primers
  • Name
    Gtf2i-pA, Gtf2i-pB
  • Primer 1 Sequence
    TGAACTTGATAAACTCCGCA
  • Primer 2 Sequence
    CTGAAGCAGAAAGTGGAGAA
  • ID
    MGI:2137620
  • Product Size
    2.5 kb
  • Synonyms
    S4, S5
Genes
Gtf2i general transcription factor II I
Polymorphisms
J:65086 Valero MC, et al., Genomics. 2000 Oct 1;69(1):1-13
Endonuclease Gene Allele Fragments Strains
MspI Gtf2i b not given C57BL/6JEiJ
s not given SPRET/EiJ
References
J:43550 Wang YK, et al., A mouse single-copy gene, Gtf2i, the homolog of human GTF2I, that is duplicated in the Williams-Beuren syndrome deletion region. Genomics. 1998 Mar 1;48(2):163-70
J:65086 Valero MC, et al., Fine-scale comparative mapping of the human 7q11.23 region and the orthologous region on mouse chromosome 5G: the low-copy repeats that flank the williams-beuren syndrome deletion arose at breakpoint sites of an evolutionary inversion(s) [In Process Citation]. Genomics. 2000 Oct 1;69(1):1-13

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory