About   Help   FAQ
OR10, OR11 Primer Detail
Primers
  • Name
    OR10, OR11
  • Primer 1 Sequence
    AATGGCCCCGGTCAACTTCC
  • Primer 2 Sequence
    GCTGGGCCTCCTCCTCTATTCTC
  • ID
    MGI:1934216
  • Product Size
    0.19 kb
Genes
Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Psd pleckstrin and Sec7 domain containing
Polymorphisms
J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72
Endonuclease Gene Allele Fragments Strains
Nfkb2 a not given 129, (C57BL/6 x C57BLKS-Pitx3ak)F1, C57BL/6
c not given CAST/EiJ
d not given DBA/2
s not given SPRET/EiJ
Psd a not given 129, (C57BL/6 x C57BLKS-Pitx3ak)F1, C57BL/6
c not given CAST/EiJ
d not given DBA/2
s not given SPRET/EiJ
References
J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory