About   Help   FAQ
A039-F, A039-R Primer Detail
Primers
  • Name
    A039-F, A039-R
  • Primer 1 Sequence
    AAACGGAGTCCACGAAATTG
  • Primer 2 Sequence
    GTCCGGTCCCCTGTAAAAAT
  • ID
    MGI:1934198
  • Product Size
    0.19 kb
Genes
A039 DNA segment, A039
Polymorphisms
J:68175 Rieger DK, et al., Genomics. 2001 Feb 15;72(1):61-72
Notes: Polymorphisms for this primer pair were identified by conformational variation.
Endonuclease Gene Allele Fragments Strains
A039 a not given 129, (C57BL/6 x C57BLKS-Pitx3ak)F1
b not given C57BL/6
c not given CAST/EiJ
d not given DBA/2
s not given SPRET/EiJ
References
J:68175 Rieger DK, et al., A double-deletion mutation in the pitx3 gene causes arrested lens development in aphakia mice. Genomics. 2001 Feb 15;72(1):61-72
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory