D11Pas18-pA, D11Pas18-pB Primer Detail MGI Mouse MGI:1930605

About Help FAQ

D11Pas18-pA, D11Pas18-pB Primer Detail

Name

D11Pas18-pA, D11Pas18-pB
Primer 1 Sequence

GATCGTCGCTATAACCCTCCA
Primer 2 Sequence

GGCTTGATGCACCCACCAC
ID

MGI:1930605
Product Size

498bp

D11Pas18

DNA segment, Chr 11, Pasteur Institute 18

J:64704 Cohen-Tannoudji M, et al., Genomics. 2000 Sep 15;68(3):273-82

Gene	Allele	Fragments	Strains
D11Pas18	b	not given	C57BL/6
	c	not given	BALB/c
	d	not given	DDK
	s	not given	SEG

J:64704 Cohen-Tannoudji M, et al., A 2-Mb YAC/BAC-based physical map of the ovum mutant (Om) locus region on mouse chromosome 11. Genomics. 2000 Sep 15;68(3):273-82

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13