About   Help   FAQ
LS3 Probe Detail
Nucleotide
Probe/Clone
  • Name
    LS3
  • Sequence Type
    oligo
  • ID
    MGI:18632
  • Region Covered
    a portion of the coding region (CTTACATCTTTATGGGGCCAGAG)
  • Insert Size
    23bp
Source
  • Species
    mouse, laboratory
  • Strain
    BALB/c
  • Tissue
    pooled
  • Tissue Description
    thymus and B-lymphocytes
Genes
Iapls3-1 intracisternal A particle, lymphocyte specific 3-1
Iapls3-10 intracisternal A particle, lymphocyte specific 3-10
Iapls3-11 intracisternal A particle, lymphocyte specific 3-11
Iapls3-12 intracisternal A particle, lymphocyte specific 3-12
Iapls3-13 intracisternal A particle, lymphocyte specific 3-13
Iapls3-14 intracisternal A particle, lymphocyte specific 3-14
Iapls3-15 intracisternal A particle, lymphocyte specific 3-15
Iapls3-16 intracisternal A particle, lymphocyte specific 3-16
Iapls3-17 intracisternal A particle, lymphocyte specific 3-17
Iapls3-18 intracisternal A particle, lymphocyte specific 3-18
Iapls3-19 intracisternal A particle, lymphocyte specific 3-19
Iapls3-2 intracisternal A particle, lymphocyte specific 3-2
Iapls3-20 intracisternal A particle, lymphocyte specific 3-20
Iapls3-21 intracisternal A particle, lymphocyte specific 3-21
Iapls3-22 intracisternal A particle, lymphocyte specific 3-22
Iapls3-24 intracisternal A particle, lymphocyte specific 3-24
Iapls3-26 intracisternal A particle, lymphocyte specific 3-26
Iapls3-27 intracisternal A particle, lymphocyte specific 3-27
Iapls3-3 intracisternal A particle, lymphocyte specific 3-3
Iapls3-38 intracisternal A particle, lymphocyte specific 3-38
Iapls3-4 intracisternal A particle, lymphocyte specific 3-4
Iapls3-40 intracisternal A particle, lymphocyte specific 3-40
Iapls3-42 intracisternal A particle, lymphocyte specific, probe 3-42
Iapls3-5 intracisternal A particle, lymphocyte specific 3-5
Iapls3-6 intracisternal A particle, lymphocyte specific 3-6
Iapls3-7 intracisternal A particle, lymphocyte specific 3-7
Iapls3-8 intracisternal A particle, lymphocyte specific 3-8
Iapls3-9 intracisternal A particle, lymphocyte specific 3-9
Iapls3-41 intracisternal A particle, lymphocyte specific 3-41
Iapls3-39 intracisternal A particle, lymphocyte specific 3-39
Iapls3-37 intracisternal A particle, lymphocyte specific 3-37
Iapls3-35 intracisternal A particle, lymphocyte specific 3-35
Iapls3-34 intracisternal A particle, lymphocyte specific 3-34
Iapls3-31 intracisternal A particle, lymphocyte specific 3-31
Iapls3-30 intracisternal A particle, lymphocyte specific 3-30
Iapls3-29 intracisternal A particle, lymphocyte specific 3-29
Iapls3-28 intracisternal A particle, lymphocyte specific 3-28
Iapls3-25 intracisternal A particle, lymphocyte specific 3-25
Iapls3-51 intracisternal A particle, lymphocyte specific, probe 3-51
Iapls3-46 intracisternal A particle, lymphocyte specific, probe 3-46
Iapls3-54 intracisternal A particle, lymphocyte specific, probe 3-54
Iapls3-49 intracisternal A particle, lymphocyte specific, probe 3-49
Iapls3-67 intracisternal A particle, lymphocyte specific, probe 3-67
Iapls3-66 intracisternal A particle, lymphocyte specific, probe 3-66
Iapls3-43 intracisternal A particle, lymphocyte specific, probe 3-43
Iapls3-69 intracisternal A particle, lymphocyte specific, probe 3-69
Iapls3-52 intracisternal A particle, lymphocyte specific, probe 3-52
Iapls3-50 intracisternal A particle, lymphocyte specific, probe 3-50
Iapls3-47 intracisternal A particle, lymphocyte specific, probe 3-47
Iapls3-44 intracisternal A particle, lymphocyte specific, probe 3-44
Iapls3-68 intracisternal A particle, lymphocyte specific, probe 3-68
Iapls3-45 intracisternal A particle, lymphocyte specific, probe 3-45
Iapls3-53 intracisternal A particle, lymphocyte specific, probe 3-53
Iapls3-65 intracisternal A particle, lymphocyte specific 3-65
Polymorphisms
J:3879 Lueders KK, et al., Mamm Genome. 1993;4(2):69-77
Notes: The LS3 probe hybridizes to multiple Iapls loci. Alleles are a=presence, b=absence.
Endonuclease Gene Allele Fragments Strains
Not Specified Iapls3-1 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-2 a present C57BL/6J
b absent DBA/2J
Not Specified Iapls3-3 a present C57BL/6J
b absent DBA/2J
Not Specified Iapls3-4 a present C57BL/6J
b absent DBA/2J
Not Specified Iapls3-5 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-6 a present C57BL/6J
b absent DBA/2J
Not Specified Iapls3-7 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-8 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-9 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-10 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-11 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-12 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-13 a present C57BL/6By, C57BL/6J
b absent BALB/cBy, DBA/2J
Not Specified Iapls3-14 a present C57BL/6J
b absent DBA/2J
Not Specified Iapls3-15 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-16 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-17 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-18 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-19 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-20 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-21 a present DBA/2J
b absent C57BL/6J
Not Specified Iapls3-22 a present DBA/2J
b absent C57BL/6J
J:20038 Lueders KK, et al., Mamm Genome. 1994 Aug;5(8):473-8
Endonuclease Gene Allele Fragments Strains
HindIII Iapls3-1 b ~19.0kb C57BL/6J
s absent M. spretus
HindIII Iapls3-2 b ~13.0kb C57BL/6J
s absent M. spretus
HindIII Iapls3-3 b ~12.0kb C57BL/6J
s absent M. spretus
HindIII Iapls3-4 b ~9.5kb C57BL/6J
s absent M. spretus
HindIII Iapls3-5 b ~7.9kb C57BL/6J
s absent M. spretus
HindIII Iapls3-6 b ~6.1kb C57BL/6J
s absent M. spretus
HindIII Iapls3-7 b ~5.9kb C57BL/6J
s absent M. spretus
HindIII Iapls3-9 b ~4.4kb C57BL/6J
s absent M. spretus
HindIII Iapls3-10 b ~2.9kb C57BL/6J
s absent M. spretus
HindIII Iapls3-11 b ~1.8kb C57BL/6J
s absent M. spretus
HindIII Iapls3-12 b ~0.8kb C57BL/6J
s absent M. spretus
HindIII Iapls3-13 b ~0.5kb C57BL/6J
s absent M. spretus
HindIII Iapls3-14 b ~0.4kb C57BL/6J
s absent M. spretus
HindIII Iapls3-24 b ~9.3kb C57BL/6J
s absent M. spretus
HindIII Iapls3-25 b ~5.3kb C57BL/6J
s absent M. spretus
HindIII Iapls3-26 b ~5.2kb C57BL/6J
s absent M. spretus
HindIII Iapls3-27 b ~3.7kb C57BL/6J
s absent M. spretus
HindIII Iapls3-28 b ~3.6kb C57BL/6J
s absent M. spretus
HindIII Iapls3-29 b ~3.3kb C57BL/6J
s absent M. spretus
HindIII Iapls3-30 b ~2.8kb C57BL/6J
s absent M. spretus
HindIII Iapls3-31 b ~2.6kb C57BL/6J
s absent M. spretus
HindIII Iapls3-35 b ~1.6kb C57BL/6J
s absent M. spretus
HindIII Iapls3-37 b ~1.5kb C57BL/6J
s absent M. spretus
HindIII Iapls3-40 b ~0.35kb C57BL/6J
s absent M. spretus
HindIII Iapls3-41 b ~0.2kb C57BL/6J
s absent M. spretus
HindIII Iapls3-42 b ~0.1kb C57BL/6J
s absent M. spretus
J:22798 Lueders KK, Mamm Genome. 1995 Feb;6(2):134-6
Endonuclease Gene Allele Fragments Strains
HindIII Iapls3-2 b ~9.0kb C57BL/6J
d absent C57BLKS/J, DBA/2J
HindIII Iapls3-11 b ~1.6kb C57BL/6J
d absent C57BLKS/J, DBA/2J
HindIII Iapls3-18 b absent C57BL/6J
d ~3.8kb C57BLKS/J, DBA/2J
HindIII Iapls3-19 b absent C57BL/6J
d ~3.0kb C57BLKS/J, DBA/2J
HindIII Iapls3-20 b absent C57BL/6J
d ~1.4kb C57BLKS/J, DBA/2J
HindIII Iapls3-26 b ~4.1kb C57BL/6J, DBA/2J
d absent C57BLKS/J
HindIII Iapls3-38 b ~1.3kb C57BL/6J
d absent C57BLKS/J, DBA/2J
J:24190 Lueders KK, Mouse Genome. 1995;93(1):161-163
Endonuclease Gene Allele Fragments Strains
HindIII Iapls3-1 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-4 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-7 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-8 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-9 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-10 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-11 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-12 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-13 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-14 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-25 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-26 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-35 b present C57BL/6J
h absent C3H/HeJ
HindIII Iapls3-65 b absent C57BL/6J
h present C3H/HeJ
HindIII Iapls3-66 b absent C57BL/6J
h present C3H/HeJ
HindIII Iapls3-67 b absent C57BL/6J
h present C3H/HeJ
HindIII Iapls3-68 b absent C57BL/6J
h present C3H/HeJ
HindIII Iapls3-69 b absent C57BL/6J
h present C3H/HeJ
J:24203 Lueders KK, Electrophoresis. 1995 Feb;16(2):179-85
Endonuclease Gene Allele Fragments Strains
Not Specified Iapls3-1 a absent A/J
b ~18.0kb C57BL/6J
Not Specified Iapls3-4 a absent A/J
b ~9.2kb C57BL/6J
Not Specified Iapls3-5 a absent A/J
b ~6.8kb C57BL/6J
Not Specified Iapls3-7 a absent A/J
b ~5.2kb C57BL/6J
Not Specified Iapls3-8 a absent A/J
b ~4.9kb C57BL/6J
Not Specified Iapls3-9 a absent A/J
b ~4.3kb C57BL/6J
Not Specified Iapls3-10 a absent A/J
b ~2.6kb C57BL/6J
Not Specified Iapls3-11 a absent A/J
b ~1.9kb C57BL/6J
Not Specified Iapls3-12 a absent A/J
b ~1.5kb C57BL/6J
Not Specified Iapls3-14 a absent A/J
b ~1.1kb C57BL/6J
Not Specified Iapls3-25 a absent A/J
b ~4.6kb C57BL/6J
Not Specified Iapls3-43 a ~6.5kb A/J
b absent C57BL/6J
Not Specified Iapls3-44 a ~5.3kb A/J
b absent C57BL/6J
Not Specified Iapls3-45 a ~5.0kb A/J
b absent C57BL/6J
Not Specified Iapls3-46 a absent A/J
b ~4.2kb C57BL/6J
Not Specified Iapls3-47 a ~2.8kb A/J
b absent C57BL/6J
Not Specified Iapls3-49 a ~2.5kb A/J
b absent C57BL/6J
Not Specified Iapls3-50 a ~2.5kb A/J
b absent C57BL/6J
Not Specified Iapls3-51 a absent A/J
b ~2.4kb C57BL/6J
Not Specified Iapls3-52 a ~2.0kb A/J
b absent C57BL/6J
Not Specified Iapls3-53 a ~2.0kb A/J
b absent C57BL/6J
Not Specified Iapls3-54 a ~1.7kb A/J
b absent C57BL/6J
References
J:3879 Lueders KK, et al., Genomic mapping of intracisternal A-particle proviral elements. Mamm Genome. 1993;4(2):69-77
J:20038 Lueders KK, et al., Mapping of mouse intracisternal A-particle proviral markers in an interspecific backcross. Mamm Genome. 1994 Aug;5(8):473-8
J:22798 Lueders KK, Differences in intracisternal A-particle and GLN proviral loci suggest a genetic contribution from a DBA/2-like strain in generation of the C57BL/Ks strain. Mamm Genome. 1995 Feb;6(2):134-6
J:24190 Lueders KK, Mapping of mouse intracisternal A-particle proviral markers in the BXH RI series. Mouse Genome. 1995;93(1):161-163
J:24203 Lueders KK, Multilocus genomic mapping with intracisternal A-particle proviral oligonucleotide probes hybridized to mouse DNA in dried agarose gels. Electrophoresis. 1995 Feb;16(2):179-85

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory