About   Help   FAQ
Fragment 2-pA1, Fragment 2-pB1 Primer Detail
Primers
  • Name
    Fragment 2-pA1, Fragment 2-pB1
  • Primer 1 Sequence
    ATCGCCTTTCGTCATGCAAGGCAG
  • Primer 2 Sequence
    AAATATCCCAGGTGGAAGGAAATT
  • ID
    MGI:1860644
  • Region Covered
    coding region
  • Product Size
    193bp
Genes
Tlr5 toll-like receptor 5
Polymorphisms
J:61532 Sebastiani G, et al., Genomics. 2000 Mar 15;64(3):230-40
Endonuclease Gene Allele Fragments Strains
Not Specified Tlr5 a not given 129P3/J, A/J, AKR/J, BALB/cJ, BUB/BnJ, C3H/HeJ, C3H/HeN, C57BL/6J, C57BL/10J, C57BL/10ScCr, C57BR/cdJ, C57L/J, C58/J, CAST/EiJ, CBA/J, DBA/1J, DBA/2J, NOD/J, NZB/BlNJ, P/J, PERA/EiJ, PERA/Rk, PERC/EiJ, RBA/DnJ, RBB/DnJ, RF/J, RIIIS/J, SF/CamEiJ, SK/CamEi, SK/CamRk, TIRANO/EiJ
b not given B6.KB2-Cln8mnd, C3H/HeOuJ, C3HeB/FeJ, CZECHII/EiJ, M. spretus, MOLC/RkJ, MOLD/RkJ, MOLE/Rk, MOLF/EiJ, MOLG/DnJ, NZW/LacJ, SKIVE/EiJ, ZALENDE/EiJ
c not given M. caroli
References
J:61532 Sebastiani G, et al., Cloning and characterization of the murine toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics. 2000 Mar 15;64(3):230-40

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory