About   Help   FAQ
Epcs50F, Epcs50R Primer Detail
Primers
  • Name
    Epcs50F, Epcs50R
  • Primer 1 Sequence
    AATAAGGGAAACCGTGCTGC
  • Primer 2 Sequence
    GTCTGAGATAGCAGATGGAC
  • ID
    MGI:1860300
Genes
Pfpl pore forming protein-like
Polymorphisms
J:62506 Hemberger M, et al., Dev Biol. 2000 Jun 1;222(1):158-69
Endonuclease Gene Allele Fragments Strains
SpeI Pfpl b not given C57BL/6
s not given M. spretus
References
J:62506 Hemberger M, et al., cDNA subtraction cloning reveals novel genes whose temporal and spatial expression indicates association with trophoblast invasion. Dev Biol. 2000 Jun 1;222(1):158-69

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/02/2024
MGI 6.13
The Jackson Laboratory