About   Help   FAQ
mStag3f, mStag3r Primer Detail
Primers
  • Name
    mStag3f, mStag3r
  • Primer 1 Sequence
    CCTCTCCCCTTCTCCACTTA
  • Primer 2 Sequence
    CCTCCCTACCCAACTCCTAT
  • ID
    MGI:1855665
  • Region Covered
    3' untranslated region
  • Product Size
    241bp
  • Synonyms
    Stag3-pA, Stag3-pB
Genes
Stag3 STAG3 cohesin complex component
Polymorphisms
J:60873 Pezzi N, et al., FASEB J. 2000 Mar;14(3):581-92
Endonuclease Gene Allele Fragments Strains
AluI Stag3 b 241bp C57BL/6J
s 195bp M. spretus
J:65086 Valero MC, et al., Genomics. 2000 Oct 1;69(1):1-13
Endonuclease Gene Allele Fragments Strains
AIuI Stag3 b not given C57BL/6JEiJ
s not given SPRET/EiJ
References
J:60873 Pezzi N, et al., STAG3, a novel gene encoding a protein involved in meiotic chromosome pairing and location of STAG3-related genes flanking the Williams-Beuren syndrome deletion. FASEB J. 2000 Mar;14(3):581-92
J:65086 Valero MC, et al., Fine-scale comparative mapping of the human 7q11.23 region and the orthologous region on mouse chromosome 5G: the low-copy repeats that flank the williams-beuren syndrome deletion arose at breakpoint sites of an evolutionary inversion(s) [In Process Citation]. Genomics. 2000 Oct 1;69(1):1-13

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory