mStag3f, mStag3r Primer Detail MGI Mouse MGI:1855665

mStag3f, mStag3r Primer Detail

Name

mStag3f, mStag3r
Primer 1 Sequence

CCTCTCCCCTTCTCCACTTA
Primer 2 Sequence

CCTCCCTACCCAACTCCTAT
ID

MGI:1855665
Region Covered

3' untranslated region
Product Size

241bp
Synonyms

Stag3-pA, Stag3-pB

Stag3

STAG3 cohesin complex component

J:60873 Pezzi N, et al., FASEB J. 2000 Mar;14(3):581-92

Endonuclease	Gene	Allele	Fragments	Strains
AluI	Stag3	b	241bp	C57BL/6J
AluI	Stag3	s	195bp	M. spretus

J:65086 Valero MC, et al., Genomics. 2000 Oct 1;69(1):1-13

Endonuclease	Gene	Allele	Fragments	Strains
AIuI	Stag3	b	not given	C57BL/6JEiJ
AIuI	Stag3	s	not given	SPRET/EiJ

J:60873 Pezzi N, et al., STAG3, a novel gene encoding a protein involved in meiotic chromosome pairing and location of STAG3-related genes flanking the Williams-Beuren syndrome deletion. FASEB J. 2000 Mar;14(3):581-92

J:65086 Valero MC, et al., Fine-scale comparative mapping of the human 7q11.23 region and the orthologous region on mouse chromosome 5G: the low-copy repeats that flank the williams-beuren syndrome deletion arose at breakpoint sites of an evolutionary inversion(s) [In Process Citation]. Genomics. 2000 Oct 1;69(1):1-13

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23