Actsk-A, Actsk-B Primer Detail MGI Mouse MGI:166

About Help FAQ

Actsk-A, Actsk-B Primer Detail

Name

Actsk-A, Actsk-B
Primer 1 Sequence

CTCGATGACGGTCAATCCCGAG
Primer 2 Sequence

CCCCCACAAGGCTGTCAGTCAG
ID

MGI:166
Product Size

238, 270, 230bp
Synonyms

Actsk-pA, Actsk-pB

Acta1

actin alpha 1, skeletal muscle

J:3743 Alonso S, et al., Mamm Genome. 1993;4(1):15-20

Gene	Allele	Fragments	Strains
Acta1	b	238.0bp	BALB/c
	c	270.0bp	C3H/HeJ, C57BL/6J
	s	230.0bp	M. spretus

J:3742 Abonia JP, et al., Linkage of Agt and Actsk-1 to distal mouse chromosome 8 loci: a new conserved linkage. Mamm Genome. 1993;4(1):25-32

J:3743 Alonso S, et al., Re-localization of Actsk-1 to mouse chromosome 8, a new region of homology with human chromosome 1. Mamm Genome. 1993;4(1):15-20

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23