About   Help   FAQ
230A, 230B Primer Detail
Primers
  • Name
    230A, 230B
  • Primer 1 Sequence
    CGCACGCACATATCTGTACGCATGCGCAAA
  • Primer 2 Sequence
    CAAGCTAGCACACGTGCTGGCGGAGTGTGG
  • ID
    MGI:161
  • Product Size
    170bp
Genes
DXPas29 DNA segment, Chr X, Pasteur Institute 29
Polymorphisms
J:14461 Simmler MC, et al., Mamm Genome. 1993 Sep;4(9):523-30
Notes: Genomic DNA from YAC PA-2 was amplified by PCR, electrophoresed on a 6% polyacrylamide denaturing gel and analyzed using autoradiography using a radiolabeled oligo (GT)>10< probe.
Endonuclease Gene Allele Fragments Strains
DXPas29 a not given 3H1, 101, 129S2/SvPas, C3H-Pgk1a, C3H/HePas, C57BL/10J, C57BR/cdJ, C57L/J, CBA/Pas
b not given AKR/Pas, C57BL/10Pas, DBA/1J, DBA/2J, JU/Ct
c not given MAI
d not given PWK, SEG/Pas, WLA, WMP
References
J:14461 Simmler MC, et al., Mapping the murine Xce locus with (CA)n repeats. Mamm Genome. 1993 Sep;4(9):523-30
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory