DXMit1-pA, DXMit1-pB Primer Detail MGI Mouse MGI:146

DXMit1-pA, DXMit1-pB Primer Detail

Name

DXMit1-pA, DXMit1-pB
Primer 1 Sequence

CAGCAAGCAACCGAGGAAGACATCC
Primer 2 Sequence

CTAGCCAGGATGCTAATCACCCTGC
ID

MGI:146
Other IDs

DXMit1-pA (BROAD)
DXMit1-pB (BROAD)

DXMit1.2

DNA segment, Chr X, Massachusetts Institute of Technology 1.2

J:4132 Angel TA, et al., Mamm Genome. 1993;4(3):171-6

Gene	Allele	Fragments	Strains
DXMit1.2	b	110.0bp	C57BL/6J-A^w-J/J
	c	118.0bp	M. m. castaneus
	h	96.0bp	C3H
	s	106.0bp	M. spretus

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit1.2	b	0.97kb	B10.D2-H2^d, C57BL/6
Not Specified	DXMit1.2	c	0.84kb	B10.BR-H2^k, BALB.K-H2^k, BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:4132 Angel TA, et al., Genetic mapping of the X-linked dominant mutations striated (Str) and bare patches (Bpa) to a 600-kb region of the mouse X chromosome: implications for mapping human disorders in Xq28. Mamm Genome. 1993;4(3):171-6

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13