About   Help   FAQ
primer 5, primer 6 Primer Detail
Primers
  • Name
    primer 5, primer 6
  • Primer 1 Sequence
    CCTTCAATGGATCCCAGTCCAAGGAGGAGG
  • Primer 2 Sequence
    GTTCTAGACTCAAGCTTCATCTGTGTG
  • ID
    MGI:138
  • Product Size
    888bp
Genes
Vwf Von Willebrand factor
Polymorphisms
J:12631 Barrow LL, et al., Mamm Genome. 1993;4(6):343-5
Endonuclease Gene Allele Fragments Strains
Vwf b ~590bp C57BL/6J
s ~400bp SPRET/EiJ
J:18453 Nichols WC, et al., Blood. 1994 Jun 1;83(11):3225-31
Notes: PCR amplified fragment was digested with RsaI, fractionated on a 4% agarose gel, and visualized after staining with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
RsaI Vwf a 426,214,127,99,22bp RIIIS/J
b 240,214,186,127,99,22bp PWK/PhJ
References
J:12631 Barrow LL, et al., Conserved linkage of neurotrophin-3 and von Willebrand factor on mouse chromosome 6. Mamm Genome. 1993;4(6):343-5
J:18453 Nichols WC, et al., von Willebrand disease in the RIIIS/J mouse is caused by a defect outside of the von Willebrand factor gene [published erratum appears in Blood 1995 Sep 15;86(6):2461]. Blood. 1994 Jun 1;83(11):3225-31

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory