About   Help   FAQ
primer 3, primer 4 Primer Detail
Primers
  • Name
    primer 3, primer 4
  • Primer 1 Sequence
    TCCGGTGCCTTACAGTCTGCTG
  • Primer 2 Sequence
    TGTACTCAGTAGTTCTTCCTAGGAG
  • ID
    MGI:137
  • Product Size
    115bp, 123bp
Genes
Vwf Von Willebrand factor
Polymorphisms
J:12631 Barrow LL, et al., Mamm Genome. 1993;4(6):343-5
Endonuclease Gene Allele Fragments Strains
Vwf b 115bp C57BL/6J
c 119bp CAST/EiJ
J:18453 Nichols WC, et al., Blood. 1994 Jun 1;83(11):3225-31
Endonuclease Gene Allele Fragments Strains
Vwf a 115bp RIIIS/J
b 123bp PWK/PhJ
References
J:12631 Barrow LL, et al., Conserved linkage of neurotrophin-3 and von Willebrand factor on mouse chromosome 6. Mamm Genome. 1993;4(6):343-5
J:18453 Nichols WC, et al., von Willebrand disease in the RIIIS/J mouse is caused by a defect outside of the von Willebrand factor gene [published erratum appears in Blood 1995 Sep 15;86(6):2461]. Blood. 1994 Jun 1;83(11):3225-31

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory