m-F-12, m-R-4 Primer Detail MGI Mouse MGI:1351517

About Help FAQ

m-F-12, m-R-4 Primer Detail

Name

m-F-12, m-R-4
Primer 1 Sequence

GTATCAGGACTACTATGAGGT
Primer 2 Sequence

GAAGCTAACATCTCAGGCAC
ID

MGI:1351517
Region Covered

intron 8 of the Phr1 gene
Product Size

0.722kb

Plekhb1

pleckstrin homology domain containing, family B (evectins) member 1

J:58784 Xu S, et al., J Biol Chem. 1999 Dec 10;274(50):35676-85

Endonuclease	Gene	Allele	Fragments	Strains
MspI	Plekhb1	b	0.238, 0.484kb	C57BL/6J
MspI	Plekhb1	s	0.722kb	M. spretus

J:58784 Xu S, et al., PHR1 encodes an abundant, pleckstrin homology domain-containing integral membrane protein in the photoreceptor outer segments. J Biol Chem. 1999 Dec 10;274(50):35676-85

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23