About   Help   FAQ
D10Mit10 Primer Detail
Primers
  • Name
    D10Mit10
  • Primer 1 Sequence
    CCAGTCTCAAAACAACAACAAAC
  • Primer 2 Sequence
    TTGCACCTAGATTGCCTGA
  • ID
    MGI:1344766
  • Product Size
    180
  • Other IDs
    D10Mit10 (BROAD)
  • Note
    MIT assay: M7
    Additional information: MIT STS Marker Data Files
Genes
D10Mit10 DNA segment, Chr 10, Massachusetts Institute of Technology 10
Polymorphisms
J:4406 Taylor RG, et al., Genomics. 1993 Apr;16(1):231-40
Endonuclease Gene Allele Fragments Strains
D10Mit10 a not given C3H/HeJ
b not given C57BL/6J
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit10 b larger C57BL/6J
f smaller FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit10 a largest C57BL/6, JF1
b smaller MSM/Ms
c smallest DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit10 a 128bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
b 136bp CAST/EiJ
c 160bp SPRET/EiJ
d 180bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit10 l larger LG/J
s smaller SM/J
References
J:4406 Taylor RG, et al., Identification of the mutation in murine histidinemia (his) and genetic mapping of the murine histidase locus (Hal) on chromosome 10. Genomics. 1993 Apr;16(1):231-40
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory