D10Mit10 Primer Detail MGI Mouse MGI:1344766

D10Mit10 Primer Detail

Name

D10Mit10
Primer 1 Sequence

CCAGTCTCAAAACAACAACAAAC
Primer 2 Sequence

TTGCACCTAGATTGCCTGA
ID

MGI:1344766
Product Size

180
Other IDs

D10Mit10 (BROAD)
Note

MIT assay: M7
Additional information: MIT STS Marker Data Files

D10Mit10

DNA segment, Chr 10, Massachusetts Institute of Technology 10

J:4406 Taylor RG, et al., Genomics. 1993 Apr;16(1):231-40

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit10	a	not given	C3H/HeJ
	D10Mit10	b	not given	C57BL/6J

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit10	b	larger	C57BL/6J
	D10Mit10	f	smaller	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit10	a	largest	C57BL/6, JF1
		b	smaller	MSM/Ms
		c	smallest	DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit10	a	128bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	b	136bp	CAST/EiJ
	c	160bp	SPRET/EiJ
	d	180bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit10	l	larger	LG/J
	D10Mit10	s	smaller	SM/J

J:4406 Taylor RG, et al., Identification of the mutation in murine histidinemia (his) and genetic mapping of the murine histidase locus (Hal) on chromosome 10. Genomics. 1993 Apr;16(1):231-40

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13