About   Help   FAQ
Flk1-pG, Flk1-pH Primer Detail
Primers
  • Name
    Flk1-pG, Flk1-pH
  • Primer 1 Sequence
    AGAACACCAAAAGAGAGGAACG
  • Primer 2 Sequence
    GCACACAGGCAGAAACCAGTAG
  • ID
    MGI:1341979
  • Synonyms
    Kdr-pA, Kdr-pB
Genes
Kdr kinase insert domain protein receptor
Expression
  • Assay Results
    26
References
J:26845 Fong GH, et al., Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995 Jul 6;376(6535):66-70
J:56426 Bi W, et al., The transcription factor MEF2C-null mouse exhibits complex vascular malformations and reduced cardiac expression of angiopoietin 1 and VEGF. Dev Biol. 1999 Jul 15;211(2):255-67
J:60748 Yang J, et al., Mekk3 is essential for early embryonic cardiovascular development. Nat Genet. 2000 Mar;24(3):309-13
J:77725 Regan CP, et al., Erk5 null mice display multiple extraembryonic vascular and embryonic cardiovascular defects. Proc Natl Acad Sci U S A. 2002 Jul 9;99(14):9248-53
J:201739 Zhu Q, et al., SnoN facilitates ALK1-Smad1/5 signaling during embryonic angiogenesis. J Cell Biol. 2013 Sep 16;202(6):937-50

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory