About   Help   FAQ
Ephx1ex7F, Ephx1ex7R Primer Detail
Primers
  • Name
    Ephx1ex7F, Ephx1ex7R
  • Primer 1 Sequence
    GCTGTGCTCTGAATGACTCT
  • Primer 2 Sequence
    CTCTCCAGGCCTCCATCC
  • ID
    MGI:1338260
  • Product Size
    109bp
Genes
Ephx1 epoxide hydrolase 1, microsomal
Polymorphisms
J:55357 Hartsfield JK Jr, et al., MGI Direct Data Submission. 1999;
Notes: Polymorphism detected within codon 338 in which the b allele is a C and the c allele is a T
Endonuclease Gene Allele Fragments Strains
Bsi YI Ephx1 b 86, 23bp 129P3/J, AKR/J, AU/SsJ, BALB/cByJ, C3H/HeJ, C57BL/6J, C57BLKS/J, C57BR/cdJ, C57L/J, HRS/J, LG/J, MA/MyJ, PL/J, RF/J, RIIIS/J, SEA/GnJ, SEC/1ReJ, SJL/J, SWR/J
d 109bp A/HeJ, A/J, BUB/BnJ, CBA/CaJ, CBA/J, DBA/1J, DBA/2J
References
J:55357 Hartsfield JK Jr, et al., Mapping of Ephx1 to Chromosome 1. MGI Direct Data Submission. 1999;
J:64722 Hartsfield JK Jr, et al., The ephx1(d) allele encoding an Arg338Cys substitution is associated with heat lability. Mamm Genome. 2000 Oct;11(10):915-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory