About   Help   FAQ
Stk10-pA, Stk10-pB Primer Detail
Primers
  • Name
    Stk10-pA, Stk10-pB
  • Primer 1 Sequence
    GCTGACTTTGCTTTGTGTATGTCG
  • Primer 2 Sequence
    AGGTTCCAATGCATTGGTCCTAGG
  • ID
    MGI:1337647
  • Region Covered
    part of 3' untranslated region
Genes
Stk10 serine/threonine kinase 10
Polymorphisms
J:54854 Kuramochi S, et al., Immunogenetics. 1999 May;49(5):369-75
Endonuclease Gene Allele Fragments Strains
Stk10 a not given A/J
b not given C57BL/6J
c not given C3H/HeJ
d not given DBA/2J
k not given AKR/J
m not given MA/MyJ
p not given P/J
s not given MSM/Ms
w not given SWR/J
x not given 129X1/SvJ
References
J:54854 Kuramochi S, et al., Molecular cloning of the human gene STK10 encoding lymphocyte-oriented kinase, and comparative chromosomal mapping of the human, mouse, and rat homologues. Immunogenetics. 1999 May;49(5):369-75

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory