D1Sta8-pA, D1Sta8-pB Primer Detail MGI Mouse MGI:1335149

About Help FAQ

D1Sta8-pA, D1Sta8-pB Primer Detail

Name

D1Sta8-pA, D1Sta8-pB
Primer 1 Sequence

TCTGCTTTCTGCTCTGCTGA
Primer 2 Sequence

ATGAGTCTCAGTCAAGGCTTCC
ID

MGI:1335149
Product Size

0.162kb

D1Sta8

DNA segment, Chr 1, Philip Stanier 8

AF084219 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:52606 Eddleston J, et al., Genomics. 1999 Mar 1;56(2):149-59

Endonuclease	Gene	Allele	Fragments	Strains
	D1Sta8	c	not given	CBA/Ca
	D1Sta8	l	not given	LPT/LeJ

J:52606 Eddleston J, et al., Physical and transcriptional map of a 3-Mb region of mouse chromosome 1 containing the gene for the neural tube defect mutant loop-tail (Lp). Genomics. 1999 Mar 1;56(2):149-59

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13