About   Help   FAQ
VEcad-pA, VEcad-pB Primer Detail
Primers
  • Name
    VEcad-pA, VEcad-pB
  • Primer 1 Sequence
    GGATGCAGAGGCTCACAGAG
  • Primer 2 Sequence
    CTGGCGGTTCACGTTGGACT
  • ID
    MGI:1334607
  • Region Covered
    nucleotides 97 - 323
  • Synonyms
    VECD-pF, VECD-pR
Genes
Cdh5 cadherin 5
Expression
  • Assay Results
    12
References
J:54181 Vittet D, et al., Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps. Blood. 1996 Nov 1;88(9):3424-31
J:54177 Gory-Faure S, et al., Role of vascular endothelial-cadherin in vascular morphogenesis. Development. 1999 May;126(10):2093-102
J:76370 Minasi MG, et al., The meso-angioblast: a multipotent, self-renewing cell that originates from the dorsal aorta and differentiates into most mesodermal tissues. Development. 2002 Jun;129(11):2773-83
J:99326 Kuhnert F, et al., Dosage-dependent requirement for mouse Vezf1 in vascular system development. Dev Biol. 2005 Jul 1;283(1):140-156
J:154872 Kondo N, et al., Thrombin induces rapid disassembly of claudin-5 from the tight junction of endothelial cells. Exp Cell Res. 2009 Oct 15;315(17):2879-87

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory