About   Help   FAQ
D2Mit51-pA, D2Mit51-pB Primer Detail
Primers
  • Name
    D2Mit51-pA, D2Mit51-pB
  • Primer 1 Sequence
    GTGAGGGGTCAATGCCACCA
  • Primer 2 Sequence
    GGCTCAGTTGTAAGCACAAG
  • ID
    MGI:1332444
Genes
D2Mit51 DNA segment, Chr 2, Massachusetts Institute of Technology 51
Polymorphisms
J:52789 Williamson CM, et al., Genet Res. 1998 Dec;72(3):255-65
Notes: The T26H +/+ + parent is produced from crosses to C3H/HeH and the T26H Gdf5/+Gdf5 parent is produced from crosses to a Harwell stock LL.
Endonuclease Gene Allele Fragments Strains
D2Mit51 b 0.134kb STOCK T(2;8)26H Gdf5bp
t 0.142kb STOCK T(2;8)26H
References
J:52789 Williamson CM, et al., Imprinting of distal mouse chromosome 2 is associated with phenotypic anomalies in utero. Genet Res. 1998 Dec;72(3):255-65
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory