F777, F779 Primer Detail MGI Mouse MGI:1330727

About Help FAQ

F777, F779 Primer Detail

Name

F777, F779
Primer 1 Sequence

AAGCATTGACAAAACCCCC
Primer 2 Sequence

GCAGAAACTTTAAAATGCGAGG
ID

MGI:1330727

DXYHgu1

DNA segment, Chr XY, Human Genetics Unit 1

J:52077 Korobova O, et al., Genomics. 1998 Dec 15;54(3):556-9

Endonuclease	Gene	Allele	Fragments	Strains
	DXYHgu1	c	not given	C3H/HeSnJ
	DXYHgu1	d	not given	CAST/EiJ

J:52077 Korobova O, et al., Patchy fur, a mouse coat mutation associated with X-Y nondisjunction, maps to the pseudoautosomal boundary region. Genomics. 1998 Dec 15;54(3):556-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13