trkA-pA, trkA-pB Primer Detail MGI Mouse MGI:1329895

About Help FAQ

trkA-pA, trkA-pB Primer Detail

Name

trkA-pA, trkA-pB
Primer 1 Sequence

CGTCATGGCTGCTTTTATGG
Primer 2 Sequence

ACTGGCGAGAAGGAGACAG
ID

MGI:1329895

Ntrk1

neurotrophic tyrosine kinase, receptor, type 1

Assay Results

39

J:52517 Wyatt S, et al., Regulation of expression of mRNAs encoding the nerve growth factor receptors p75 and trkA in developing sensory neurons. Development. 1993 Nov;119(3):635-48

J:29041 Davies AM, et al., NGF receptor expression in sensory neurons develops normally in embryos lacking NGF. Dev Biol. 1995 Oct;171(2):434-8

J:87350 Wyatt S, et al., Regulation of nerve growth factor receptor gene expression in sympathetic neurons during development. J Cell Biol. 1995 Sep;130(6):1435-46

J:41123 Wyatt S, et al., Sympathetic neuron survival and TrkA expression in NT3-deficient mouse embryos. EMBO J. 1997 Jun 2;16(11):3115-23

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13