About   Help   FAQ
beta-major-pC, beta-major-pD Primer Detail
Primers
  • Name
    beta-major-pC, beta-major-pD
  • Primer 1 Sequence
    CTGACAGATGCTCTCTTGGG
  • Primer 2 Sequence
    CACAACCCCAGAAACAGACA
  • ID
    MGI:1329249
  • Synonyms
    Hbb-b1-pF, Hbb-b1-pR
Genes
Hbb-b1 hemoglobin, beta adult major chain
Expression
  • Assay Results
    15
References
J:19573 Weiss MJ, et al., Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells. Genes Dev. 1994 May 15;8(10):1184-97
J:31156 Lin CS, et al., Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis. Genes Dev. 1996 Jan 15;10(2):154-64
J:35594 Kieran MW, et al., Thrombopoietin rescues in vitro erythroid colony formation from mouse embryos lacking the erythropoietin receptor. Proc Natl Acad Sci U S A. 1996 Aug 20;93(17):9126-31
J:353480 Huang S, et al., Mutations in linker-2 of KLF1 impair expression of membrane transporters and cytoskeletal proteins causing hemolysis. Nat Commun. 2024 Aug 15;15(1):7019

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory