About   Help   FAQ
Hba-x-pA, Hba-x-pB Primer Detail
Primers
  • Name
    Hba-x-pA, Hba-x-pB
  • Primer 1 Sequence
    GCTCAGGCCGAGCCCATTGG
  • Primer 2 Sequence
    TAGCGGTACTTCTCAGTCAG
  • ID
    MGI:1328823
  • Product Size
    0.37kb
Genes
Hba-x hemoglobin X, alpha-like embryonic chain in Hba complex
Expression
  • Assay Results
    7
References
J:19573 Weiss MJ, et al., Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells. Genes Dev. 1994 May 15;8(10):1184-97
J:23061 Shivdasani RA, et al., Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature. 1995 Feb 2;373(6513):432-4
J:36249 Fujiwara Y, et al., Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12355-8
J:40963 Niki M, et al., Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc Natl Acad Sci U S A. 1997 May 27;94(11):5697-702

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory