About   Help   FAQ
Hbb-bh1-pC, Hbb-bh1-pD Primer Detail
Primers
  • Name
    Hbb-bh1-pC, Hbb-bh1-pD
  • Primer 1 Sequence
    AGTCCCCATGGAGTCAAAGA
  • Primer 2 Sequence
    CTCAAGGAGACCTTTGCTCA
  • ID
    MGI:1328822
  • Product Size
    0.26kb
Genes
Hbb-bh1 hemoglobin Z, beta-like embryonic chain
Expression
  • Assay Results
    16
References
J:19573 Weiss MJ, et al., Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells. Genes Dev. 1994 May 15;8(10):1184-97
J:26846 Shalaby F, et al., Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995 Jul 6;376(6535):62-6
J:27458 Robb L, et al., Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci U S A. 1995 Jul 18;92(15):7075-9
J:31156 Lin CS, et al., Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis. Genes Dev. 1996 Jan 15;10(2):154-64
J:35594 Kieran MW, et al., Thrombopoietin rescues in vitro erythroid colony formation from mouse embryos lacking the erythropoietin receptor. Proc Natl Acad Sci U S A. 1996 Aug 20;93(17):9126-31
J:36249 Fujiwara Y, et al., Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12355-8
J:40963 Niki M, et al., Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc Natl Acad Sci U S A. 1997 May 27;94(11):5697-702

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory