D14Sfk4-pA, D14Sfk4-pB Primer Detail MGI Mouse MGI:1303139

About Help FAQ

D14Sfk4-pA, D14Sfk4-pB Primer Detail

Name

D14Sfk4-pA, D14Sfk4-pB
Primer 1 Sequence

TTGGCCATGCAGGCAAACAC
Primer 2 Sequence

CCTAATGTCTCCATTAACAAA
ID

MGI:1303139

D14Sfk4

DNA segment, Chr 14, Stephen F. Kingsmore 4

J:46919 Detter JC, et al., Nucleic Acids Res. 1998 Sep 1;26(17):4091-2

Gene	Allele	Fragments	Strains
D14Sfk4	b	255bp	C57BL/6JEiJ
	c	255bp	CAST/EiJ
	p	270bp	PWK

J:46919 Detter JC, et al., Identification of novel simple sequence length polymorphisms (SSLPs) in mouse by interspersed repetitive element (IRE)-PCR. Nucleic Acids Res. 1998 Sep 1;26(17):4091-2

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13