About   Help   FAQ
gas5-pA, gas5-pB Primer Detail
Primers
  • Name
    gas5-pA, gas5-pB
  • Primer 1 Sequence
    TAACTATTTGTTTGTTGTAGGTGC
  • Primer 2 Sequence
    TGACTTTACCATTTCATTTTCTGG
  • ID
    MGI:1290080
  • Region Covered
    exon 5
  • Note
    This clone is derived from a gene that produces alternate transcripts.
Genes
Gas5 growth arrest specific 5
Polymorphisms
J:49652 Muller AJ, et al., Mamm Genome. 1998 Sep;9(9):773-4
Endonuclease Gene Allele Fragments Strains
Not Specified Gas5 a 55bp 129X1/SvJ, A/J, C3H/HeJ, LP/J, LT.CAST-A/J, NZW/LacJ
b 60bp AKR/J, BALB/cJ, C57BL/6J, DBA/2J, FVB/NJ, M. spretus, NOD/ShiLtJ, NON/ShiLtJ, Swiss
References
J:49652 Muller AJ, et al., The gas5 gene is disrupted by a frameshift mutation within its longest open reading frame in several inbred mouse strains and maps to murine chromosome 1. Mamm Genome. 1998 Sep;9(9):773-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory