About   Help   FAQ
D14Sh1-pA, D14Sh1-pB Primer Detail
Primers
  • Name
    D14Sh1-pA, D14Sh1-pB
  • Primer 1 Sequence
    AGCATTGGAAATGTAAATGAGC
  • Primer 2 Sequence
    CCCTGAAATAATCCCAGATACTT
  • ID
    MGI:1277547
  • Region Covered
    3' end and flanking sequences
Genes
D14Sh1 DNA segment, Chr 14, Steve Hardies 1
Polymorphisms
J:48983 Zhao Y, et al., Mamm Genome. 1998 Aug;9(8):679-80
Endonuclease Gene Allele Fragments Strains
Not Specified D14Sh1 b present C57BL/6J, C57BR/cdJ, SJL/J, SWR/J
s absent A/J, AKR/J, BALB/cByJ, BALB/cJ, C3H/HeJ, C57BLKS/J, C58/J, CAST/EiJ, CBA/J, CZECHII/EiJ, DBA/2J, DMZ, LP/J, M. m. domesticus poschiavinus (Tirano), M. m. domesticus poschiavinus (Zalende), M. spretus (D3878 Morocco), M. spretus (D3879 Morocco), M. spretus (D3889 Spain), M. spretus (D3890 Spain), M. spretus (D3891 Spain), MOLC/RkJ, MOLD/RkJ, MOLE/Rk, MOLF/EiJ, MOLG/DnJ, NON/ShiLt, PERA/EiJ, RBA/DnJ, RBB/DnJ, SEG, SK/CamEi, SK/CamRk, SMZ, SPRET/EiJ, STF, WSB/EiJ
References
J:48983 Zhao Y, et al., Mus spretus LINE-1s in C57BL/6J map to at least two different chromosomes. Mamm Genome. 1998 Aug;9(8):679-80
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory