About   Help   FAQ
Pou5f1-pA, Pou5f1-pB Primer Detail
Primers
  • Name
    Pou5f1-pA, Pou5f1-pB
  • Primer 1 Sequence
    GGCGTTCTCTTTGGAAAGGTGTTC
  • Primer 2 Sequence
    CTCGAACCACATCCTTCTCT
  • ID
    MGI:1276409
  • Region Covered
    exons 2-5
  • Product Size
    312bp
  • Synonyms
    Oct3/4-pF, Oct3/4-pR, Oct4-pA, Oct4-pB
Genes
Pou5f1 POU domain, class 5, transcription factor 1
Expression
  • Assay Results
    17
References
J:48570 Botquin V, et al., New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2. Genes Dev. 1998 Jul 1;12(13):2073-90
J:51139 Nichols J, et al., Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell. 1998 Oct 30;95(3):379-91
J:83414 Tanaka TS, et al., Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. Genome Res. 2002 Dec;12(12):1921-8
J:126338 Yagi R, et al., Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development. 2007 Nov;134(21):3827-36
J:157698 Ideguchi M, et al., Murine embryonic stem cell-derived pyramidal neurons integrate into the cerebral cortex and appropriately project axons to subcortical targets. J Neurosci. 2010 Jan 20;30(3):894-904
J:227640 Economou C, et al., Intrinsic factors and the embryonic environment influence the formation of extragonadal teratomas during gestation. BMC Dev Biol. 2015;15:35

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory