About   Help   FAQ
Igf2-pE, Igf2-pH Primer Detail
Primers
  • Name
    Igf2-pE, Igf2-pH
  • Primer 1 Sequence
    GGCCCCGGAGAGACTCTGTGC
  • Primer 2 Sequence
    TGGGGGTGGGTAAGGAGAAAG
  • ID
    MGI:1276398
  • Region Covered
    from amino acid 3
Genes
Igf2 insulin-like growth factor 2
Expression
  • Assay Results
    54
References
J:48541 Dean W, et al., Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: association with aberrant phenotypes. Development. 1998 Jun;125(12):2273-82
J:68165 Weber M, et al., Extensive tissue-specific variation of allelic methylation in the Igf2 gene during mouse fetal development: relation to expression and imprinting. Mech Dev. 2001 Mar;101(1-2):133-41
J:91593 Lewis A, et al., Tandem repeat hypothesis in imprinting: deletion of a conserved direct repeat element upstream of H19 has no effect on imprinting in the Igf2-H19 region. Mol Cell Biol. 2004 Jul;24(13):5650-6
J:130398 Wagschal A, et al., G9a histone methyltransferase contributes to imprinting in the mouse placenta. Mol Cell Biol. 2008 Feb;28(3):1104-13

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory