About   Help   FAQ
Mash2-pA, Mash2-pB Primer Detail
Primers
  • Name
    Mash2-pA, Mash2-pB
  • Primer 1 Sequence
    TTAGGGGGCTACTGAGCATC
  • Primer 2 Sequence
    AAGTCCTGATGCTGCAAGGT
  • ID
    MGI:1267086
  • Region Covered
    includes intron 2
  • Synonyms
    Ascl2-pA, Ascl2-pB
Genes
Ascl2 achaete-scute family bHLH transcription factor 2
Expression
  • Assay Results
    71
References
J:47668 Caspary T, et al., Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol Cell Biol. 1998 Jun;18(6):3466-74
J:94241 Umlauf D, et al., Imprinting along the Kcnq1 domain on mouse chromosome 7 involves repressive histone methylation and recruitment of Polycomb group complexes. Nat Genet. 2004 Dec;36(12):1296-300
J:96366 Cerrato F, et al., The two-domain hypothesis in Beckwith-Wiedemann syndrome: autonomous imprinting of the telomeric domain of the distal chromosome 7 cluster. Hum Mol Genet. 2005 Feb 15;14(4):503-11
J:130398 Wagschal A, et al., G9a histone methyltransferase contributes to imprinting in the mouse placenta. Mol Cell Biol. 2008 Feb;28(3):1104-13

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory