About   Help   FAQ
MKCP-1, MKC-4 Primer Detail
Primers
  • Name
    MKCP-1, MKC-4
  • Primer 1 Sequence
    TGTGTGTCTGTATATAACAT
  • Primer 2 Sequence
    GGAAGATAGGATGGAGCTGG
  • ID
    MGI:125
Genes
Igkc immunoglobulin kappa constant
Polymorphisms
J:4306 Solin ML, et al., Immunogenetics. 1993;37(6):401-7
Notes: Genomic DNA was amplified via symmetric PCR with the indicated primers. Successive rounds of PCR were performed using asymmetric and/or nested PCR and th resulting products were directly sequenced. The strains were arranged into allele groupings based onsequence similarity. For more information about the primers used in the secondary PCR, please see the reference.
Endonuclease Gene Allele Fragments Strains
Igkc a 0.39kb AKR, C58/J, PL
b 0.39kb A/J, BALB/c, C57BL/6J, CBA, CE, DBA/2, NZB/J, RIII
c 0.39kb SJL
References
J:4306 Solin ML, et al., Immunoglobulin constant kappa gene alleles in twelve strains of mice. Immunogenetics. 1993;37(6):401-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory