About   Help   FAQ
49.MMIL1BG Primer Detail
Primers
  • Name
    49.MMIL1BG
  • Primer 1 Sequence
    CCAAGCTTCCTTGTGCAAGTA
  • Primer 2 Sequence
    AAGCCCAAAGTCCATCAGTGG
  • ID
    MGI:124
  • Product Size
    257bp
  • Synonyms
    49MMIL1BG, MMIL1BG, T15
Genes
D2Nds3 DNA segment, Chr 2, Nuffield Department of Surgery 3
Il1b interleukin 1 beta
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Il1b d larger B6.PL-Thy1a, B10.H2nod, C57BL/6J, DBA/2J, NOD
n smaller NON
s smallest M. spretus
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Il1b a largest BALB/cPas
b 2nd largest PWK/Pas
c 3rd largest 129S2/SvPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
d 4th largest SEG/Pas, SPE/Pas, SPR/Smh
J:44 Moen CJ, et al., Oncogene. 1992 Mar;7(3):563-6
Endonuclease Gene Allele Fragments Strains
Il1b c 400nt BALB/cHeA
s 250nt STS/A
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D2Nds3 e 280bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
f 190bp CAST/EiJ
g 400bp BALB/cJ
h 270bp AKR/J, LP/J, NON/ShiLt
s 140bp SPRET/EiJ
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Il1b a largest BALB/cCrc
b smallest A/JCrc, AKR/Nimr, B10.D2-H2d/Nimr, C3H/HeCrc, C57L/J, C58/OlaCrc, CBA/CaCrc, NOD/Crc, NZW/Ola
J:14462 Zuberi AR, et al., Mamm Genome. 1993 Sep;4(9):516-22
Endonuclease Gene Allele Fragments Strains
D2Nds3 b not given B10.UW, C57BL/6
c not given CAST
J:16399 Everett ET, et al., Mamm Genome. 1994 Jan;5(1):55-7
Endonuclease Gene Allele Fragments Strains
Il1b b not given C57BL/6J
c not given CAST/EiJ
J:18309 Hess EJ, et al., Genomics. 1994 May 1;21(1):257-61
Endonuclease Gene Allele Fragments Strains
D2Nds3 h 280bp C3H/HeJ
s 138bp M. spretus
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Nds3 a 400bp BALB/cW
b 280bp A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
c 270bp 129/SvW, AKR/W
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:44 Moen CJ, et al., Scc-1, a novel colon cancer susceptibility gene in the mouse: linkage to CD44 (Ly-24, Pgp-1) on chromosome 2. Oncogene. 1992 Mar;7(3):563-6
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:14462 Zuberi AR, et al., High-resolution mapping of a minor histocompatibility antigen gene on mouse chromosome 2. Mamm Genome. 1993 Sep;4(9):516-22
J:16399 Everett ET, et al., The tight-skin (Tsk) mutation is closely linked to B2m on mouse chromosome 2. Mamm Genome. 1994 Jan;5(1):55-7
J:18309 Hess EJ, et al., Deletion map of the coloboma (Cm) locus on mouse chromosome 2. Genomics. 1994 May 1;21(1):257-61
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory