About   Help   FAQ
st96_108 Primer Detail
Primers
  • Name
    st96_108
  • Primer 1 Sequence
    CTTTGGATCAAAGCTGGACTG
  • Primer 2 Sequence
    TCACACAGCACGTAGAATTTCA
  • ID
    MGI:1204281
  • Region Covered
    First primer covers from base 2988 through 3008 in sequence L13103; second primer covers from 3151 through 3172.
  • Product Size
    185
Genes
Map3k1 mitogen-activated protein kinase kinase kinase 1
Expression
  • Assay Results
    46
Sequences
References
J:46439 Freeman TC, et al., Expression Mapping of Mouse Genes. MGI Direct Data Submission. 1998;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory