D6Rck359-pA, D6Rck359-pB Primer Detail MGI Mouse MGI:1101082

About Help FAQ

D6Rck359-pA, D6Rck359-pB Primer Detail

Name

D6Rck359-pA, D6Rck359-pB
Primer 1 Sequence

AAGCTTTGGCTGGTCCCTCGGG
Primer 2 Sequence

CCATCCCAGACACTCCTCCGTGC
ID

MGI:1101082
Product Size

281 bp

D6Rck359

DNA segment, Chr 6, Rockefeller University 359

J:42057 De Jager PL, et al., Genome Res. 1997 Jul;7(7):736-46

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Rck359	b	not given	B6CBACa-A^w-J/A
Not Specified	D6Rck359	c	not given	CAST/EiJ

J:42057 De Jager PL, et al., An approximately 1.2-Mb bacterial artificial chromosome contig refines the genetic and physical maps of the lurcher locus on mouse chromosome 6 [letter]. Genome Res. 1997 Jul;7(7):736-46

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13