About   Help   FAQ
Mapping Data
Experiment
  • Experiment
    TEXT-Genetic Cross
  • Chromosome
    7
  • Reference
    J:80767 Watabe-Rudolph M, et al., The mouse rib-vertebrae mutation is a hypomorphic Tbx6 allele. Mech Dev. 2002 Dec;119(2):251-6
  • ID
    MGI:2448611
Genes
GeneAlleleAssay TypeDescription
Tbx6 Tbx6rv visible phenotype
D7Mit164 PCR
D7Mit188 PCR
D7Mit165
Notes
  • Experiment
    Rib-vertebrae Tbx6rv allele arose in C57BL/6 mice and was maintained on a mixed 129/C57 genetic background. Interspecific backcross animals were generated by mating rv/rv with (rv/rv CAST/Ei)F1 and (rv/rv MOLF/Ei)F1 animals. A total of 2487 meioses were analysed.
    The locus order was as follows (in cM standard error) D7Mit164 - (1 +/-0.2) - Tbx6rv - (0.04 +/-0.04) - D7Mit188 - (1 +/- 0.2) - D7Mit165. An identified STS was the closest marker to rv and was identified using the following primers: rv2kb-5_for CAGAAAGGCATAGTCCTGGAAC rv2kb-5_rev TGGTAGTTTGAATAACGATGGC).. The region containing the rv allele was narrowed to approximately 250 kb.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory