About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:79434 Loomes KM, et al., Characterization of Notch receptor expression in the developing mammalian heart and liver. Am J Med Genet. 2002 Oct 1;112(2):181-9
Assay type: RT-PCR
MGI Accession ID: MGI:6501988
Gene symbol: Notch4
Gene name: notch 4
Probe: Notch4-pG, Notch4-pH
Probe preparation: labelled with FAM
Assay notes: This assay is a quantitative RT-PCR. All expression levels were relative to levels detected at E11.5, and normalized with respect to Gapdh expression. (FAM)AACCGTTAAGCTCATTGTCTCCCCCA(TAMRA) was used as the probe.
Results Image: 1D
 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified (a) Amount Genetic BackgroundMutant Allele(s)Sex
E11 E11.5 TS19: heart Weak 1 µg CD-1 Not Specified
E12 E12.5 TS20: heart Weak 1 µg CD-1 Not Specified
E13 E13.5 TS21: heart Weak 1 µg CD-1 Not Specified
E15 E15.5 TS23: heart Weak 1 µg CD-1 Not Specified
E18 E18.5 TS26: heart Weak 1 µg CD-1 Not Specified
NB P newborn TS27: heart Weak 1 µg CD-1 Not Specified
2WK P w 2 TS28: heart Present (b) 1 µg CD-1 Not Specified
12WK P w 12 TS28: heart Present (c) 1 µg CD-1 Not Specified
Notes:
(a) Expression remained at low levels throughout gestation and rised sharply by 12 weeks of age.
(b) About 75 times the initial level.
(c) About 30 times the initial level.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory