About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:285868 Kong X, et al., Plac1 (placenta-specific 1) is widely expressed during fetal development and is associated with a lethal form of hydrocephalus. Birth Defects Res A Clin Mol Teratol. 2013 Sep;97(9):571-7
Assay type: RT-PCR
MGI Accession ID: MGI:6404627
Gene symbol: Plac1
Gene name: placental specific protein 1
Probe: Plac1-pC, Plac1-pD
Assay notes: This assay is a quantitative RT-PCR. Taqman probe (TCAAAGGCCCAACTGCGATTGTCCA) was used.
Results Image: 2A
 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified (a) Amount Genetic BackgroundMutant Allele(s)Sex
E18 E18.0 TS26: brain Present 2 µg; total RNA C57BL/6J Not Specified
P1 P1 TS27: brain Weak 2 µg; total RNA C57BL/6J Not Specified
P7 P7 TS28: brain Weak 2 µg; total RNA C57BL/6J Not Specified
P14 P14 TS28: brain Trace 2 µg; total RNA C57BL/6J Not Specified
P30 P30 TS28: brain Trace 2 µg; total RNA C57BL/6J Not Specified
P60 P60 TS28: brain Weak 2 µg; total RNA C57BL/6J Not Specified
Notes:
(a) Significant expression was observed at E18, whereas it was markedly reduced and barely detectable after birth.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory