About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:42540 Roelen BA, et al., Differential expression of BMP receptors in early mouse development. Int J Dev Biol. 1997 Aug;41(4):541-9
Assay type: RT-PCR
MGI Accession ID: MGI:6279967
Gene symbol: Acvr1
Gene name: activin A receptor, type 1
Probe: ActR-I-pC, ActR-I-pD
Visualized with: Ethidium bromide
Assay notes: Heminested PCR was performed. A nested (r) primer was used: GGCTTCCACGTCTACCAGAAAG (287-308).
Results Image: 1_ActR-I
 Sample Information Bands Other Sample Information
Lane AgeStructure 343 bp Amount Genetic BackgroundMutant Allele(s)Sex Note
100bp DNA ladder Mol. Wt. Marker Lane
zygote E0.5 (a) TS1: 1-cell stage conceptus Present 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified
2-cell E1.0 (a) TS2: 2-cell stage conceptus Present 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified
4-cell E2.0 (a) TS3: 4-cell stage conceptus Present 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified
uncompacted morula E2.5 (a) TS3: morula-stage conceptus Absent 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified 8-16 cells
compacted morula E3.0 (a) TS4: compacted morula Absent 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified
blastocyst E4.0 (a) TS5: blastocyst Present 1 µg; total RNA (C57BL/6 x CBA)F1 Not Specified late blastocyst
water Control
positive control Control
Notes:
(a) Age assigned by curator based on morphological criteria supplied by authors.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory