About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:146496 Hagan JP, et al., At least ten genes define the imprinted Dlk1-Dio3 cluster on mouse chromosome 12qF1. PLoS One. 2009;4(2):e4352
Assay type: RT-PCR
MGI Accession ID: MGI:5896435
Gene symbol: 6430411K18Rik
Gene name: RIKEN cDNA 6430411K18 gen
Probe: 522Up/847Dn
Visualized with: Ethidium bromide
Assay notes: The RT-PCR products from this reaction were subjected to restriction digest to reveal allele-specific expression and imprinting. RT reactions were performed with either random hexamers or the strand-specific primers for Peg11 477: TGGGTTCTGAGGCTTAGGGTGATAGAG (gene Rtl1 MGI:2656842) or Anti-Peg11 1052: GAAGACACTTGGAGAGCATCGTTCG (gene 6430411K18Rik MGI:1924130). 6430411K18Rik was maternally expressed.
Results
Image: 5C ©

 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified Amount Genetic BackgroundMutant Allele(s)Sex
Gen Uncut Control
Gen NIaIII Control
Gen Uncut Control
Gen NIaIII Control
Gen Uncut Control
Gen NIaIII Control
RT- Control
Cz female x 129 male RT+ Uncut 477 P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified
Cz female x 129 male RT+ NIaIII 477 P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified
RT- Control
Cz female x 129 male RT+ Uncut 1052 P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified
Cz female x 129 male RT+ NIaIII 1052 P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified
RT- Control
Cz female x 129 male RT+ Uncut Random P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified
Cz female x 129 male RT+ NIaIII Random P adult TS28: brain Present Not Specified involves: 129S1/SvImJ * CZECHII/EiJ Not Specified

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory