About   Help   FAQ
Antibody
Detail
Antibody
Name: Anti-Emp2
Host: rabbit
Type: Polyclonal
Note: Antibody preparation described in Wang, C. et al., (2001) Blood 97:3890-3895.
MGI Accession ID: MGI:7516304
Antigen
Species: mouse, laboratory
Region covered: first extracellular region of the gene (from amino acid 16 to 64)
Note: The immunogen was a glutathione-S-transferase (GST) fusion protein. The peptide was cloned by PCR using the following primers: CGCGGATCCTCTACCATTGACAATGCCTGG (forward; contains BamH1 site); CCGGAATTCTTACGCCTGCATCACAGAATAACC (reverse, contains EcoR1 site).
Gene Emp2  epithelial membrane protein 2
Expression Gene Expression Data (24 results)
Reference J:109419 Wadehra M, et al., Dev Biol. 2006 Apr 15;292(2):430-41

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory