Pom121l12^em1Kzt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pom121l12^em1Kzt
• Name: POM121 membrane glycoprotein-like 12; endonuclease-mediated mutation 1, Keizo Tokuhiro
• MGI ID: MGI:8475111
• Gene: Pom121l12 Location: Chr11:14549276-14550314 bp, + strand Genetic Position: Chr11, 8.34 cM
• Alliance: Pom121l12^em1Kzt page

Mutation origin

• Strain of Origin: (C57BL/6NCrSlc x DBA/2CrSlc)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination generated a 671 bp deletion within exon 1 using gRNAs CCTAGACCTTCGGTGCCTGG and TGTGACCCCTGTCGACCCCC. (J:392877)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pom121l12 Mutation: 11 strains or lines available

References

• Original: J:392877 Takemoto K, et al., Functional analysis of genes enriched in male reproductive organs: validation via fertility assessment of 14 knockout mouse lines. Front Cell Dev Biol. 2026;14:1851315
• All: 1 reference(s)