Satl1^em1Zuk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Satl1^em1Zuk
• Name: spermidine/spermine N1-acetyl transferase-like 1; endonuclease-mediated mutation 1, Martin M Matzuk
• MGI ID: MGI:8475104
• Gene: Satl1 Location: ChrX:111294002-111316476 bp, - strand Genetic Position: ChrX, 48.76 cM, cytoband E2
• Alliance: Satl1^em1Zuk page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details:

  CRISPR/Cas9-mediated recombination generated a 22,186 bp deletion that includes exons 2-5 and part of exons 1 and 6, with a 1 bp insertion using gRNAs CAACCAGGCACTTATCAATC and TGAGTACTATACTCGCCTAG. (J:392877)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Satl1 Mutation: 10 strains or lines available

References

• Original: J:392877 Takemoto K, et al., Functional analysis of genes enriched in male reproductive organs: validation via fertility assessment of 14 knockout mouse lines. Front Cell Dev Biol. 2026;14:1851315
• All: 1 reference(s)