Cd69^{em1(cre/ERT2)Parsa}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd69^{em1(cre/ERT2)Parsa}
• Name: CD69 antigen; endonuclease-mediated mutation 1, Roham Parsa
• MGI ID: MGI:8460360
• Synonyms: Cd69-CreERT2
• Gene: Cd69 Location: Chr6:129244287-129252332 bp, - strand Genetic Position: Chr6, 63.21 cM
• Alliance: Cd69^{em1(cre/ERT2)Parsa} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inducible, Recombinase)
• Inducer: tamoxifen
• Mutation: Insertion
• Cd69^{em1(cre/ERT2)Parsa} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  mouse	Cd69 (MGI:88343)

• Mutation details:

  A sgRNA (AGCAAGCCCTCCAGATGACG) was designed to replace the stop codon in the last exon, exon 5, of the CD69 antigen (Cd69) gene with a P2A sequence fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence. (J:101977, J:393363)

Recombinase activity

Activity:	Tissue activity of this recombinase allele
Driver:	Cd69 (mouse) Summary of all recombinase alleles driven by Cd69. Alliance mouse Cd69 gene page

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cd69 Mutation: 27 strains or lines available

References

• Original: J:393363 Parsa R, et al., Tissue-specific clonal selection and differentiation of CD4(+) T cells during infection. Nat Immunol. 2026 Apr;27(4):725-737
• All: 2 reference(s)